| Detail of EST/Unigene CX524791 |
| Acc. | CX524791 |
| Internal Acc. | s13dNF11B02AT025_478216 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit a, chloroplastic OS=Pisum sativum E-value=3e-54; ATP synthase subunit a, chloroplastic OS=Cicer arietinum E-value=8e-53; ATP synthase subunit a, chloroplastic OS=Lotus japonicus E-value=2e-50; ATP synthase subunit a, chloroplastic OS=Glycine max E-value=4e-49; ATP synthase subunit a, chloroplastic OS=Aethionema grandiflora E-value=2e-48; |
| Length | 496 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | AGATTTATGGAATCGGTTATTATAGCATTACAAAATTGTGCAAAAATAAATATTTTGTGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |