| Detail of EST/Unigene CX524810 |
| Acc. | CX524810 |
| Internal Acc. | s13dNF11C10AT082_478254 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamyl-tRNA reductase 1, chloroplastic OS=Cucumis sativus E-value=6e-41; Glutamyl-tRNA reductase 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-36; Glutamyl-tRNA reductase 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-35; Glutamyl-tRNA reductase 2, chloroplastic OS=Cucumis sativus E-value=7e-28; Glutamyl-tRNA reductase 1, chloroplastic OS=Hordeum vulgare E-value=9e-28; |
| Length | 517 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | AAACATAAACATAAACATAGTTTTAGTTCCAAGTAACATATTACTATTATTGTCTAAGTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842198 |
| Trichome-related Gene from Literature | N/A |