| Detail of EST/Unigene CX525159 |
| Acc. | CX525159 |
| Internal Acc. | s13dNF20B06AT057_478952 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase delta chain, chloroplastic OS=Pisum sativum E-value=8e-47; ATP synthase delta chain, chloroplastic OS=Nicotiana tabacum E-value=2e-28; ATP synthase delta chain, chloroplastic OS=Spinacia oleracea E-value=2e-19; ATP synthase delta chain, chloroplastic OS=Sorghum bicolor E-value=5e-15; ATP synthase delta chain, chloroplastic OS=Chlamydomonas reinhardtii E-value=8e-09; |
| Length | 542 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | CTTCTTCATCTACCAACGCCAACAATGGCGTCTCTACAACACACCACAGCTTCAATCTAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826551 |
| Trichome-related Gene from Literature | N/A |