Detail of EST/Unigene CX525195 |
Acc. | CX525195 |
Internal Acc. | s13dNF20E10AT083_479024 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Type I inositol 1,4,5-trisphosphate 5-phosphatase CVP2 OS=Arabidopsis thaliana E-value=7e-20; Type I inositol 1,4,5-trisphosphate 5-phosphatase 1 OS=Arabidopsis thaliana E-value=4e-15; Type I inositol 1,4,5-trisphosphate 5-phosphatase 2 OS=Arabidopsis thaliana E-value=5e-15; |
Length | 511 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CTTTTGTTACTGGTGGAGGATGTTCAAGAATAGAATAAACCTTATACTACACATTTTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.1.3.36 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830380 |
Trichome-related Gene from Literature | N/A |