| Detail of EST/Unigene CX525198 |
| Acc. | CX525198 |
| Internal Acc. | s13dNF20F01AT015_479030 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Replication factor A protein 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=6e-11; Replication protein A 70 kDa DNA-binding subunit OS=Xenopus laevis E-value=6e-08; Replication protein A 70 kDa DNA-binding subunit OS=Mus musculus E-value=1e-07; Replication protein A 70 kDa DNA-binding subunit OS=Homo sapiens E-value=4e-07; Replication protein A 70 kDa DNA-binding subunit OS=Drosophila melanogaster E-value=6e-07; |
| Length | 493 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | AAAAAATCCAAGATTGAAAACGCAAGCGGTTATGGCTGTGAATCTGACACAAGGTGCGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K07466 replication factor A1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K07466 replication factor A1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834576 |
| Trichome-related Gene from Literature | N/A |