Detail of EST/Unigene CX525221 |
Acc. | CX525221 |
Internal Acc. | s13dNF20H02AT028_479076 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoribulokinase, chloroplastic OS=Mesembryanthemum crystallinum E-value=6e-69; Phosphoribulokinase, chloroplastic OS=Triticum aestivum E-value=6e-64; Phosphoribulokinase, chloroplastic OS=Spinacia oleracea E-value=1e-63; Phosphoribulokinase, chloroplastic OS=Arabidopsis thaliana E-value=4e-63; Phosphoribulokinase, chloroplastic OS=Chlamydomonas reinhardtii E-value=5e-50; |
Length | 565 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | TATTGAGTGAGAATGGCAGCTTGTACTGTCTACTCAACACAACCTCTAAGAACAAACATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840098 |
Trichome-related Gene from Literature | N/A |