Detail of EST/Unigene CX525306 |
Acc. | CX525306 |
Internal Acc. | s13dNF16G05AT040_479246 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=1e-14; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-13; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=6e-13; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=4e-11; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=2e-08; |
Length | 550 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CAACGCTACCCTTATCCACAAACAACGATATTGTTGTGTTGTTCCTTTCCTCTTCTCTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835090 |
Trichome-related Gene from Literature | N/A |