Detail of EST/Unigene CX525481 |
Acc. | CX525481 |
Internal Acc. | s13dNF21F02AT027_479596 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Lipoxygenase 6, choloroplastic OS=Arabidopsis thaliana E-value=2e-19; Lipoxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=1e-11; Lipoxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=3e-10; Linoleate 13S-lipoxygenase 3-1, chloroplastic OS=Solanum tuberosum E-value=3e-10; Probable lipoxygenase 6 OS=Oryza sativa subsp. japonica E-value=1e-08; |
Length | 527 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | GTGAAGTCTAATCCTTTACTCCTCCGATCCCCGTCGGTATTCTCCGATAAGAGGCAACGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843077 |
Trichome-related Gene from Literature | N/A |