Detail of EST/Unigene CX525544 |
Acc. | CX525544 |
Internal Acc. | s13dNF24C10AT082_479722 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit N, chloroplastic OS=Arabidopsis thaliana E-value=2e-41; Photosystem I reaction center subunit N, chloroplastic OS=Hordeum vulgare E-value=6e-32; Photosystem I reaction center subunit N, chloroplastic (Fragment) OS=Zea mays E-value=2e-31; Photosystem I reaction center subunit N, chloroplastic OS=Volvox carteri E-value=9e-21; |
Length | 521 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CACAGATCGATCAGCAGAACTAAACTAGCAATCCATTACACATGGCTGCAATGAACTCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836525 |
Trichome-related Gene from Literature | N/A |