Detail of EST/Unigene CX525560 |
Acc. | CX525560 |
Internal Acc. | s13dNF24E04AT035_479754 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoribulokinase, chloroplastic OS=Mesembryanthemum crystallinum E-value=2e-73; Phosphoribulokinase, chloroplastic OS=Triticum aestivum E-value=1e-67; Phosphoribulokinase, chloroplastic OS=Spinacia oleracea E-value=6e-67; Phosphoribulokinase, chloroplastic OS=Arabidopsis thaliana E-value=1e-66; Phosphoribulokinase, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-54; |
Length | 562 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | TACTGTCTACTCAACACAACCTCTAAGAACAAACATCTCAATTCCAACATCATCAAAAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840098 |
Trichome-related Gene from Literature | N/A |