Detail of EST/Unigene CX525575 |
Acc. | CX525575 |
Internal Acc. | s13dNF24F07AT063_479784 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 20 OS=Arabidopsis thaliana E-value=5e-40; Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=4e-36; Probable beta-1,3-galactosyltransferase 17 OS=Arabidopsis thaliana E-value=1e-35; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=3e-35; Probable beta-1,3-galactosyltransferase 16 OS=Arabidopsis thaliana E-value=2e-24; |
Length | 541 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | GTTTGTTTTTTGCACATTAAAGCAAGATTTTGCTATCCATATGACCACAATCCTTAAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.4.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827853 |
Trichome-related Gene from Literature | N/A |