Detail of EST/Unigene CX525891 |
Acc. | CX525891 |
Internal Acc. | s13dNF32A08AT065_509526 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glycine dehydrogenase [decarboxylating], mitochondrial OS=Pisum sativum E-value=1e-59; Glycine dehydrogenase [decarboxylating], mitochondrial OS=Solanum tuberosum E-value=5e-44; Glycine dehydrogenase [decarboxylating] A, mitochondrial OS=Flaveria pringlei E-value=1e-43; Glycine dehydrogenase [decarboxylating] 2, mitochondrial OS=Arabidopsis thaliana E-value=3e-43; Glycine dehydrogenase [decarboxylating] 1, mitochondrial OS=Arabidopsis thaliana E-value=1e-41; |
Length | 629 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CATAAAAACAAAATCTTCAATTTCCTTAAACAAATCAAAACCGAAAAACACTATTTTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.4.4.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829438 |
Trichome-related Gene from Literature | N/A |