| Detail of EST/Unigene CX525975 |
| Acc. | CX525975 |
| Internal Acc. | s13dNF32H09AT080_509694 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Translation factor GUF1 homolog, chloroplastic OS=Vitis vinifera E-value=0; Translation factor GUF1 homolog, chloroplastic OS=Populus trichocarpa E-value=0; Translation factor GUF1 homolog, chloroplastic OS=Ricinus communis E-value=0; Translation factor GUF1 homolog, chloroplastic OS=Arabidopsis thaliana E-value=1e-99; Translation factor GUF1 homolog, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-98; |
| Length | 616 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | GTTGCTTCAGGTTACTGGTACTGTGCCACAGCGAGAAATGAAGGAACAGTTTCTTGATAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.6.5.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830766 |
| Trichome-related Gene from Literature | N/A |