| Detail of EST/Unigene CX525997 |
| Acc. | CX525997 |
| Internal Acc. | s13dNF33B07AT061_509738 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=9e-45; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=9e-42; Probable beta-1,3-galactosyltransferase 4 OS=Arabidopsis thaliana E-value=6e-36; Probable beta-1,3-galactosyltransferase 1 OS=Arabidopsis thaliana E-value=2e-23; Probable beta-1,3-galactosyltransferase 6 OS=Arabidopsis thaliana E-value=1e-11; |
| Length | 600 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | ATCTTCTCAAACCTCAACAATCCTCTTCTTCTTTGAAATAATAACCTCTTTTTTCATTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839292 |
| Trichome-related Gene from Literature | N/A |