Detail of EST/Unigene CX526084 |
Acc. | CX526084 |
Internal Acc. | s13dNF28A11AT085_509912 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L32, chloroplastic OS=Lotus japonicus E-value=7e-09; 50S ribosomal protein L32, chloroplastic OS=Phaseolus vulgaris E-value=6e-08; 50S ribosomal protein L32, chloroplastic OS=Glycine max E-value=1e-07; 50S ribosomal protein L32, chloroplastic OS=Lobularia maritima E-value=3e-06; 50S ribosomal protein L32, chloroplastic OS=Olimarabidopsis pumila E-value=4e-06; |
Length | 625 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | ATTATTCCAATCCAACATTTTTATTTTATTTGTTACAAATTTTGATTTACCTGTAAAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |