| Detail of EST/Unigene CX526084 |
| Acc. | CX526084 |
| Internal Acc. | s13dNF28A11AT085_509912 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L32, chloroplastic OS=Lotus japonicus E-value=7e-09; 50S ribosomal protein L32, chloroplastic OS=Phaseolus vulgaris E-value=6e-08; 50S ribosomal protein L32, chloroplastic OS=Glycine max E-value=1e-07; 50S ribosomal protein L32, chloroplastic OS=Lobularia maritima E-value=3e-06; 50S ribosomal protein L32, chloroplastic OS=Olimarabidopsis pumila E-value=4e-06; |
| Length | 625 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | ATTATTCCAATCCAACATTTTTATTTTATTTGTTACAAATTTTGATTTACCTGTAAAAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |