| Detail of EST/Unigene CX526099 |
| Acc. | CX526099 |
| Internal Acc. | s13dNF28C02AT018_509942 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit a, chloroplastic OS=Manihot esculenta E-value=8e-63; ATP synthase subunit a, chloroplastic OS=Fagopyrum esculentum subsp. ancestrale E-value=7e-62; ATP synthase subunit a, chloroplastic OS=Ceratophyllum demersum E-value=1e-61; ATP synthase subunit a, chloroplastic OS=Pisum sativum E-value=2e-61; ATP synthase subunit a, chloroplastic OS=Nymphaea alba E-value=3e-61; |
| Length | 612 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | GTTGGGCGGTCGTAGATTTATGGAATCGGTTATTATAGCATTACAAAATTGTGCAAAAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |