Detail of EST/Unigene CX526099 |
Acc. | CX526099 |
Internal Acc. | s13dNF28C02AT018_509942 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit a, chloroplastic OS=Manihot esculenta E-value=8e-63; ATP synthase subunit a, chloroplastic OS=Fagopyrum esculentum subsp. ancestrale E-value=7e-62; ATP synthase subunit a, chloroplastic OS=Ceratophyllum demersum E-value=1e-61; ATP synthase subunit a, chloroplastic OS=Pisum sativum E-value=2e-61; ATP synthase subunit a, chloroplastic OS=Nymphaea alba E-value=3e-61; |
Length | 612 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | GTTGGGCGGTCGTAGATTTATGGAATCGGTTATTATAGCATTACAAAATTGTGCAAAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |