Detail of EST/Unigene CX526162 |
Acc. | CX526162 |
Internal Acc. | s13dNF28H07AT064_510068 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 72C1 OS=Arabidopsis thaliana E-value=9e-21; Secologanin synthase OS=Catharanthus roseus E-value=6e-18; Cytochrome P450 734A1 OS=Arabidopsis thaliana E-value=1e-16; Cytochrome P450 734A6 OS=Oryza sativa subsp. japonica E-value=4e-10; Cytochrome P450 734A5 OS=Oryza sativa subsp. japonica E-value=4e-10; |
Length | 532 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | TGTCACTCTAAAATGGAGGTGTTTGTGTTTCCCACAGGAACAACAATAATCATCTGTGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | ; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07425 cytochrome P450, family 4, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07425 cytochrome P450, family 4, subfamily A |
EC | 1.14.-.- 1.14.15.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820690 |
Trichome-related Gene from Literature | N/A |