| Detail of EST/Unigene CX526214 |
| Acc. | CX526214 |
| Internal Acc. | s13dNF29D12AT102_510172 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase AtPK2/AtPK19 OS=Arabidopsis thaliana E-value=2e-53; Serine/threonine-protein kinase AtPK1/AtPK6 OS=Arabidopsis thaliana E-value=2e-52; Protein kinase 2 OS=Dictyostelium discoideum E-value=1e-41; RAC family serine/threonine-protein kinase homolog OS=Dictyostelium discoideum E-value=7e-38; Ribosomal protein S6 kinase beta-2 OS=Homo sapiens E-value=2e-35; |
| Length | 622 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | TTCAACGATTCCAACCCCACCAGCCCACAAGTCATACACAGTAGGTCCCACTCCTTCGTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04688 p70 ribosomal S6 kinase |
| EC | 2.7.11.1 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820019 |
| Trichome-related Gene from Literature | N/A |