Detail of EST/Unigene CX526267 |
Acc. | CX526267 |
Internal Acc. | s13dNF34A09AT069_510278 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 5'-adenylylsulfate reductase 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-47; 5'-adenylylsulfate reductase 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-46; 5'-adenylylsulfate reductase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-44; Probable 5'-adenylylsulfate reductase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-44; Protein disulfide-isomerase like 2-2 OS=Arabidopsis thaliana E-value=1e-07; |
Length | 636 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CTCAAAAACTAGATTTTATATTATTGAAACAAGCAGCATAATACAACCATAACTCTACTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 5.3.4.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825793 |
Trichome-related Gene from Literature | N/A |