Detail of EST/Unigene CX526315 |
Acc. | CX526315 |
Internal Acc. | s13dNF34E09AT071_510374 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Translation factor GUF1 homolog, chloroplastic OS=Vitis vinifera E-value=1e-71; Translation factor GUF1 homolog, chloroplastic OS=Ricinus communis E-value=3e-71; Translation factor GUF1 homolog, chloroplastic OS=Populus trichocarpa E-value=4e-69; Translation factor GUF1 homolog, chloroplastic OS=Arabidopsis thaliana E-value=7e-69; Translation factor GUF1 homolog, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-67; |
Length | 593 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CTTATCCGTTAAAACTCAACGGTTACTCCACCATTCTCAACGAACACCAATAACCGCCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.5.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830766 |
Trichome-related Gene from Literature | N/A |