| Detail of EST/Unigene CX526387 |
| Acc. | CX526387 |
| Internal Acc. | s13dNF35C09AT070_510518 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase DHAR3, chloroplastic OS=Arabidopsis thaliana E-value=8e-66; Glutathione S-transferase DHAR2 OS=Arabidopsis thaliana E-value=5e-48; Glutathione S-transferase DHAR1, mitochondrial OS=Arabidopsis thaliana E-value=4e-45; Putative glutathione S-transferase DHAR4 OS=Arabidopsis thaliana E-value=4e-39; Chloride intracellular channel protein 6 OS=Rattus norvegicus E-value=1e-12; |
| Length | 641 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | ATCTCTTACCCCTACAAACAAACGCACACAAACGTTACCAATGTCCACCGTTAGAATTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
| Probeset |
|
| Corresponding NCBI Gene | 831532 |
| Trichome-related Gene from Literature | N/A |