Detail of EST/Unigene CX526568 |
Acc. | CX526568 |
Internal Acc. | s13dNF36C07AT054_513648 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=5e-22; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-21; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=1e-19; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=5e-19; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=9e-16; |
Length | 606 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | ATTTCTACAACGCTACCCTTATCCACAAACAACGATATTGTTGTGTTGTTCCTTTCCTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835090 |
Trichome-related Gene from Literature | N/A |