Detail of EST/Unigene CX526671 |
Acc. | CX526671 |
Internal Acc. | s13dNF25D06AT058_513854 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cullin-1 OS=Arabidopsis thaliana E-value=4e-77; Putative cullin-like protein 1 OS=Arabidopsis thaliana E-value=3e-53; Cullin-2 OS=Arabidopsis thaliana E-value=2e-49; Putative cullin-like protein 2 OS=Arabidopsis thaliana E-value=8e-49; Cullin-like protein 3 OS=Arabidopsis thaliana E-value=4e-39; |
Length | 605 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CTTCGTTCTCGATTCTCCTTCACCGAAACCCTCATCAGGGTTTCTCTTACTCCATCAACG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03347 cullin 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03347 cullin 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03347 cullin 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825648 |
Trichome-related Gene from Literature | N/A |