| Detail of EST/Unigene CX526671 |
| Acc. | CX526671 |
| Internal Acc. | s13dNF25D06AT058_513854 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cullin-1 OS=Arabidopsis thaliana E-value=4e-77; Putative cullin-like protein 1 OS=Arabidopsis thaliana E-value=3e-53; Cullin-2 OS=Arabidopsis thaliana E-value=2e-49; Putative cullin-like protein 2 OS=Arabidopsis thaliana E-value=8e-49; Cullin-like protein 3 OS=Arabidopsis thaliana E-value=4e-39; |
| Length | 605 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | CTTCGTTCTCGATTCTCCTTCACCGAAACCCTCATCAGGGTTTCTCTTACTCCATCAACG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03347 cullin 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03347 cullin 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03347 cullin 1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825648 |
| Trichome-related Gene from Literature | N/A |