Detail of EST/Unigene CX526829 |
Acc. | CX526829 |
Internal Acc. | s13dNF27B01AT009_514170 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Spinacia oleracea E-value=4e-72; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=5e-71; Transketolase, chloroplastic OS=Zea mays E-value=6e-70; Transketolase, chloroplastic OS=Solanum tuberosum E-value=1e-66; Transketolase 7 OS=Craterostigma plantagineum E-value=2e-60; |
Length | 585 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CTGGATCATACAGAGTTGCCGTGCTTAACCAGAAGAGACCCTCAATTCTGGCCCTTTCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819137 |
Trichome-related Gene from Literature | N/A |