Detail of EST/Unigene CX526929 |
Acc. | CX526929 |
Internal Acc. | s13dNF37B07AT061_514370 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Peroxiredoxin Q, chloroplastic (Fragment) OS=Sedum lineare E-value=3e-65; Peroxiredoxin Q, chloroplastic OS=Populus jackii E-value=5e-65; Peroxiredoxin Q, chloroplastic OS=Arabidopsis thaliana E-value=4e-64; Peroxiredoxin Q, chloroplastic OS=Gentiana triflora E-value=9e-64; Peroxiredoxin Q, chloroplastic OS=Suaeda salsa E-value=9e-64; |
Length | 606 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | AACACAACATGTTATCACTTTGTTCTTCCTCATCCATGGCTAAGGCTTCCCTCACTCTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.11.1.15 1.11.1.7 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |