Detail of EST/Unigene CX526972 |
Acc. | CX526972 |
Internal Acc. | s13dNF37F03AT031_514456 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate kinase, cytosolic isozyme OS=Glycine max E-value=7e-49; Pyruvate kinase, cytosolic isozyme OS=Solanum tuberosum E-value=2e-46; Pyruvate kinase, cytosolic isozyme OS=Nicotiana tabacum E-value=2e-37; Probable pyruvate kinase, cytosolic isozyme OS=Arabidopsis thaliana E-value=7e-33; Pyruvate kinase OS=Dictyostelium discoideum E-value=4e-06; |
Length | 560 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | ATCCACAAAACTGTCATTTAAAATGCAAGAAATGCAGGTTAATATTGAGAAGTACTCCGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.7.1.40 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830758 |
Trichome-related Gene from Literature | N/A |