| Detail of EST/Unigene CX527072 |
| Acc. | CX527072 |
| Internal Acc. | s13dNF39F11AT095_514656 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphoenolpyruvate carboxylase 2 OS=Flaveria trinervia E-value=0; Phosphoenolpyruvate carboxylase 2 OS=Mesembryanthemum crystallinum E-value=0; Phosphoenolpyruvate carboxylase 1 OS=Sorghum bicolor E-value=0; Phosphoenolpyruvate carboxylase OS=Solanum tuberosum E-value=0; Phosphoenolpyruvate carboxylase OS=Picea abies E-value=0; |
| Length | 602 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | GAGAGATTCAAGCTGCATTTCGCACGGATGAAATTCGAAGGACTGCTCCTACACCACAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01595 phosphoenolpyruvate carboxylase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K01595 phosphoenolpyruvate carboxylase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01595 phosphoenolpyruvate carboxylase |
| EC | 4.1.1.31 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820723 |
| Trichome-related Gene from Literature | N/A |