Detail of EST/Unigene CX527133 |
Acc. | CX527133 |
Internal Acc. | s13dNF40C12AT098_514778 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Heme oxygenase 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-80; Heme oxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=5e-74; Heme oxygenase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-69; Heme oxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=1e-60; Probable inactive heme oxygenase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-44; |
Length | 625 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CTCCTATGAAACAATCGACGGTTATTGTCTCGGCGACTTCGGCAGCGGCGGAGAAGAAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.14.99.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817208 |
Trichome-related Gene from Literature | N/A |