Detail of EST/Unigene CX527265 |
Acc. | CX527265 |
Internal Acc. | s13dNF41G03AT024_515042 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin--nitrite reductase, chloroplastic OS=Betula pendula E-value=7e-75; Ferredoxin--nitrite reductase, chloroplastic OS=Arabidopsis thaliana E-value=5e-71; Ferredoxin--nitrite reductase, chloroplastic OS=Spinacia oleracea E-value=3e-69; Ferredoxin--nitrite reductase, chloroplastic (Fragment) OS=Zea mays E-value=8e-66; Ferredoxin--nitrite reductase, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-65; |
Length | 556 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | ACACACTCTCTTCTCCAAAAATGTCTTCCTTCTCAGTACGTTTCCTCACTCCACCATCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816055 |
Trichome-related Gene from Literature | N/A |