| Detail of EST/Unigene CX527266 |
| Acc. | CX527266 |
| Internal Acc. | s13dNF41G04AT036_515044 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=1e-65; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=5e-35; Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=9e-35; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=6e-18; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=2e-16; |
| Length | 613 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | GCATAACAACATTGTTGAACAGAATTGGATTCGAAATTCAAAATGCAGAGCAAGGGATCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835415 |
| Trichome-related Gene from Literature | N/A |