| Detail of EST/Unigene CX527300 |
| Acc. | CX527300 |
| Internal Acc. | s13dNF42B05AT045_515112 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=6e-31; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=2e-26; Probable beta-1,3-galactosyltransferase 4 OS=Arabidopsis thaliana E-value=6e-20; Probable beta-1,3-galactosyltransferase 1 OS=Arabidopsis thaliana E-value=2e-14; Probable beta-1,3-galactosyltransferase 8 OS=Arabidopsis thaliana E-value=9e-06; |
| Length | 610 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | AACTCAACCAACGTCCCTTACCATACTTGCAAACAAGCTACACACCCAACACAACTCACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839292 |
| Trichome-related Gene from Literature | N/A |