Detail of EST/Unigene CX527303 |
Acc. | CX527303 |
Internal Acc. | s13dNF42B08AT073_515118 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate receptor 3.1 OS=Oryza sativa subsp. japonica E-value=1e-70; Glutamate receptor 3.3 OS=Arabidopsis thaliana E-value=2e-69; Glutamate receptor 3.4 OS=Arabidopsis thaliana E-value=1e-68; Glutamate receptor 3.5 OS=Arabidopsis thaliana E-value=2e-66; Glutamate receptor 3.2 OS=Arabidopsis thaliana E-value=4e-66; |
Length | 627 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | TTTCAATGAGGGAAATCTGTTACGTAAAAGTATATATGAGGTTAACATGACTGGTGTAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signaling Molecules and Interaction > ko04080 Neuroactive ligand-receptor interaction > K05204 glutamate receptor, ionotropic, kainate 4; Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K05212 glutamate receptor, ionotropic, N-methyl-D-aspartate 2D; Environmental Information Processing > Signaling Molecules and Interaction > ko04080 Neuroactive ligand-receptor interaction > K05212 glutamate receptor, ionotropic, N-methyl-D-aspartate 2D |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.10 Glutamate-gated ion channel of neurotransmitter receptors GIC |
Probeset |
|
Corresponding NCBI Gene | 840859 |
Trichome-related Gene from Literature | N/A |