Detail of EST/Unigene CX527456 |
Acc. | CX527456 |
Internal Acc. | s13dNF44G10AT084_515424 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=1e-57; Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=3e-56; Lichenase OS=Nicotiana plumbaginifolia E-value=6e-45; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=7e-43; Glucan endo-1,3-beta-glucosidase B OS=Solanum lycopersicum E-value=9e-43; |
Length | 621 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | TCACTGCATATGAATCTCTATATAAATATGTGACTTGCAAAAATAAGTTTAGGACTCAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827320 |
Trichome-related Gene from Literature | N/A |