| Detail of EST/Unigene CX527681 |
| Acc. | CX527681 |
| Internal Acc. | s13dNF38B11AT093_515874 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chaperone protein ClpB3, chloroplastic OS=Arabidopsis thaliana E-value=7e-39; Chaperone protein ClpB2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-37; Chaperone protein ClpB3, mitochondrial OS=Oryza sativa subsp. japonica E-value=6e-25; Chaperone protein ClpB4, mitochondrial OS=Arabidopsis thaliana E-value=8e-22; Chaperone protein ClpB 2 OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=4e-16; |
| Length | 576 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | CAAACACTTCACCATGGTTTCAAACTCTCAATAAACTTTCACTGTTCACTCTCTCATCGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831398 |
| Trichome-related Gene from Literature | N/A |