Detail of EST/Unigene CX527916 |
Acc. | CX527916 |
Internal Acc. | s13dNF48G04AT036_516344 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoinositide phospholipase C 2 OS=Arabidopsis thaliana E-value=1e-41; Phosphoinositide phospholipase C 7 OS=Arabidopsis thaliana E-value=7e-40; Phosphoinositide phospholipase C 4 OS=Arabidopsis thaliana E-value=2e-34; Phosphoinositide phospholipase C 5 OS=Arabidopsis thaliana E-value=7e-32; Phosphoinositide phospholipase C 6 OS=Arabidopsis thaliana E-value=2e-31; |
Length | 621 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | GTTATCATAAAATATCAAAACATGTTATGAATAACAACAACACCTATTTTCTCAAAATTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K05857 phospholipase C, delta; Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K05857 phospholipase C, delta; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K05857 phospholipase C, delta |
EC | 3.1.4.11 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819999 |
Trichome-related Gene from Literature | N/A |