| Detail of EST/Unigene CX527931 |
| Acc. | CX527931 |
| Internal Acc. | s13dNF48H08AT076_516374 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Threonine dehydratase biosynthetic, chloroplastic OS=Arabidopsis thaliana E-value=7e-54; Threonine dehydratase biosynthetic, chloroplastic OS=Solanum lycopersicum E-value=8e-37; Threonine dehydratase, mitochondrial OS=Blastobotrys adeninivorans E-value=1e-31; L-threonine dehydratase biosynthetic IlvA OS=Burkholderia multivorans (strain ATCC 17616 / 249) E-value=5e-29; Threonine dehydratase biosynthetic, chloroplastic OS=Cicer arietinum E-value=5e-28; |
| Length | 636 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | ATCAGAATGACCCAAACCATGGAGGCGCTACGATTATCACAGCCACAACCTCACCTCCTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01752 L-serine dehydratase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01752 L-serine dehydratase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01754 threonine dehydratase; Metabolism > Amino Acid Metabolism > ko00290 Valine, leucine and isoleucine biosynthesis > K01754 threonine dehydratase |
| EC | 4.3.1.19 5.1.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820166 |
| Trichome-related Gene from Literature | N/A |