Detail of EST/Unigene CX527989 |
Acc. | CX527989 |
Internal Acc. | s13dNF50E07AT055_516490 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=1e-50; Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=6e-49; Thioredoxin M5, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-45; Thioredoxin M-type, chloroplastic OS=Zea mays E-value=4e-44; Thioredoxin M-type, chloroplastic OS=Triticum aestivum E-value=3e-42; |
Length | 597 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CACCAAAACACTAGAAGCTTATCCACAAGTGCTGAAAAACCTGACTGCACTTTCCACAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820775 |
Trichome-related Gene from Literature | N/A |