Detail of EST/Unigene CX528068 |
Acc. | CX528068 |
Internal Acc. | s13dNF51D07AT062_516648 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=5e-25; Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=5e-25; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=1e-24; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=1e-23; Beta-glucosidase 13 OS=Arabidopsis thaliana E-value=1e-21; |
Length | 628 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | TTTGAAAATCATAACTTTTAGCACTTTTCTCTCACAAATATCTTCAATAATATAAATTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834493 |
Trichome-related Gene from Literature | N/A |