Detail of EST/Unigene CX528243 |
Acc. | CX528243 |
Internal Acc. | s13dNF53C09AT070_516998 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Pisum sativum E-value=2e-95; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Phaseolus vulgaris E-value=3e-86; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Arabidopsis thaliana E-value=2e-79; Carotenoid 9,10(9',10')-cleavage dioxygenase OS=Crocus sativus E-value=1e-78; 9-cis-epoxycarotenoid dioxygenase 1, chloroplastic OS=Zea mays E-value=3e-28; |
Length | 573 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CACAAACTGAAAAAAATGGAGTCTGAGAAAATAGGAGGAGGAATTGTGAAAGTGGAACCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.14.99.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825527 |
Trichome-related Gene from Literature | N/A |