Detail of EST/Unigene CX528254 |
Acc. | CX528254 |
Internal Acc. | s13dNF53D08AT074_517020 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glucan endo-1,3-beta-glucosidase A6 OS=Arabidopsis thaliana E-value=6e-34; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=2e-19; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=2e-19; Lichenase OS=Nicotiana plumbaginifolia E-value=3e-19; Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=2e-18; |
Length | 627 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | GCAACATTGAAAATAGAAAGTAGAAACAGAGTATCAAACACACATGACATGACCACATAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819920 |
Trichome-related Gene from Literature | N/A |