| Detail of EST/Unigene CX528254 |
| Acc. | CX528254 |
| Internal Acc. | s13dNF53D08AT074_517020 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glucan endo-1,3-beta-glucosidase A6 OS=Arabidopsis thaliana E-value=6e-34; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=2e-19; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=2e-19; Lichenase OS=Nicotiana plumbaginifolia E-value=3e-19; Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=2e-18; |
| Length | 627 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | GCAACATTGAAAATAGAAAGTAGAAACAGAGTATCAAACACACATGACATGACCACATAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819920 |
| Trichome-related Gene from Literature | N/A |