Detail of EST/Unigene CX528283 |
Acc. | CX528283 |
Internal Acc. | s13dNF53G03AT024_517078 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=7e-63; Sulfite reductase [ferredoxin], chloroplastic (Fragment) OS=Glycine max E-value=8e-56; Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=4e-45; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=7e-44; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=1e-39; |
Length | 587 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | GCAGCATCTCATAGCGCACTCACTCGCACACTGTGCTCCTTTCTCTTTTCAACGCAACCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830336 |
Trichome-related Gene from Literature | 830336 |