Detail of EST/Unigene CX528352 |
Acc. | CX528352 |
Internal Acc. | s13dNF54E02AT019_517216 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase delta chain, chloroplastic OS=Pisum sativum E-value=9e-38; ATP synthase delta chain, chloroplastic OS=Nicotiana tabacum E-value=3e-20; ATP synthase delta chain, chloroplastic OS=Spinacia oleracea E-value=2e-14; ATP synthase delta chain, chloroplastic OS=Sorghum bicolor E-value=3e-10; ATP synthase delta chain, chloroplastic OS=Chlamydomonas reinhardtii E-value=7e-06; |
Length | 544 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | GAAACGCAAACAAAACACTCTCTTCATTTCATTTCACTAACCACACCACACTAATTTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826551 |
Trichome-related Gene from Literature | N/A |