| Detail of EST/Unigene CX528502 |
| Acc. | CX528502 |
| Internal Acc. | s13dNF55A12AT097_517516 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Plastidic ATP/ADP-transporter OS=Solanum tuberosum E-value=0; ADP,ATP carrier protein 2, chloroplastic OS=Arabidopsis thaliana E-value=0; ADP,ATP carrier protein 1, chloroplastic OS=Arabidopsis thaliana E-value=0; ADP,ATP carrier protein 1 OS=Chlamydia muridarum (strain MoPn / Nigg) E-value=1e-53; ADP,ATP carrier protein 1 OS=Chlamydia trachomatis (strain D/UW-3/Cx) E-value=2e-53; |
| Length | 629 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots; |
| Sequence | GTTCCTCTTCCTGAACGTAGCATAAAGAAGAAGAAGAAACCAAAAATGGGAACAATGGAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS; 2.A.12 ATP:ADP antiporter AAA |
| Probeset |
|
| Corresponding NCBI Gene | 838120 |
| Trichome-related Gene from Literature | N/A |