Detail of EST/Unigene CX528564 |
Acc. | CX528564 |
Internal Acc. | s13dNF55G04AT036_517640 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Delta(8)-fatty-acid desaturase OS=Borago officinalis E-value=4e-81; Delta(8)-fatty-acid desaturase OS=Helianthus annuus E-value=1e-78; Fatty acid desaturase 1 OS=Rattus norvegicus E-value=3e-20; Fatty acid desaturase 1 OS=Mus musculus E-value=4e-19; Fatty acid desaturase 2-like protein FADS2P1 OS=Mus musculus E-value=7e-19; |
Length | 596 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots; |
Sequence | CAAAGAAGGGGATCTATGGATCTCAATTCAGGGTAAGGTTTACAATGTTTCAGATTGGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10224 fatty acid desaturase 1 (delta-5 desaturase); Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K10226 fatty acid desaturase 2 (delta-6 desaturase); Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10226 fatty acid desaturase 2 (delta-6 desaturase) |
EC | 1.14.19.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825331 |
Trichome-related Gene from Literature | N/A |