Detail of EST/Unigene CX528692 |
Acc. | CX528692 |
Internal Acc. | s13dNF05F12MJ095_243454 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=9e-72; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=7e-63; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=3e-61; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=1e-56; |
Length | 602 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
Sequence | GCCAAATGGAGAATCGATCAGACTTGCCTTCAATGCAAGACTTTCCGGTCGACCTTGTTT |
EST members of Unigene | CX528692 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34942.1.S1_at
|
Corresponding NCBI Gene | 842869 |
Trichome-related Gene from Literature | 842869 |