| Detail of EST/Unigene CX528810 |
| Acc. | CX528810 |
| Internal Acc. | s13dNF08D08MJ062_243688 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Neurolysin, mitochondrial OS=Sus scrofa E-value=4e-08; Neurolysin, mitochondrial OS=Mus musculus E-value=3e-07; Neurolysin, mitochondrial OS=Rattus norvegicus E-value=4e-07; Neurolysin, mitochondrial OS=Oryctolagus cuniculus E-value=6e-07; Neurolysin, mitochondrial OS=Bos taurus E-value=1e-06; |
| Length | 630 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
| Sequence | AAAAAACCCTCTTCGCGCTCGTCAGGGGTTAGAAAGTAAAGACAAAACGAACGAGCAGAG |
| EST members of Unigene | CX528810 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.4.24.15 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.8222.1.S1_at
|
| Corresponding NCBI Gene | 843094 |
| Trichome-related Gene from Literature | N/A |