Detail of EST/Unigene CX528810 |
Acc. | CX528810 |
Internal Acc. | s13dNF08D08MJ062_243688 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Neurolysin, mitochondrial OS=Sus scrofa E-value=4e-08; Neurolysin, mitochondrial OS=Mus musculus E-value=3e-07; Neurolysin, mitochondrial OS=Rattus norvegicus E-value=4e-07; Neurolysin, mitochondrial OS=Oryctolagus cuniculus E-value=6e-07; Neurolysin, mitochondrial OS=Bos taurus E-value=1e-06; |
Length | 630 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
Sequence | AAAAAACCCTCTTCGCGCTCGTCAGGGGTTAGAAAGTAAAGACAAAACGAACGAGCAGAG |
EST members of Unigene | CX528810 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.24.15 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.8222.1.S1_at
|
Corresponding NCBI Gene | 843094 |
Trichome-related Gene from Literature | N/A |