| Detail of EST/Unigene CX528852 |
| Acc. | CX528852 |
| Internal Acc. | s13dNF01A10MJ069_243771 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferrochelatase-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-14; Ferrochelatase-2, chloroplastic OS=Hordeum vulgare E-value=6e-13; Ferrochelatase-2, chloroplastic OS=Cucumis sativus E-value=8e-13; Ferrochelatase-1, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=2e-12; Ferrochelatase-2, chloroplastic OS=Oryza sativa subsp. indica E-value=1e-11; |
| Length | 629 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
| Sequence | GTCCATCTCAGTTATGAACGCACTTTCACATTCTTCTCTTCTTCCCAACCGATACCCTCA |
| EST members of Unigene | CX528852 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 4.99.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10407.1.S1_at
|
| Corresponding NCBI Gene | 832672 |
| Trichome-related Gene from Literature | N/A |