Detail of EST/Unigene CX528852 |
Acc. | CX528852 |
Internal Acc. | s13dNF01A10MJ069_243771 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ferrochelatase-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-14; Ferrochelatase-2, chloroplastic OS=Hordeum vulgare E-value=6e-13; Ferrochelatase-2, chloroplastic OS=Cucumis sativus E-value=8e-13; Ferrochelatase-1, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=2e-12; Ferrochelatase-2, chloroplastic OS=Oryza sativa subsp. indica E-value=1e-11; |
Length | 629 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
Sequence | GTCCATCTCAGTTATGAACGCACTTTCACATTCTTCTCTTCTTCCCAACCGATACCCTCA |
EST members of Unigene | CX528852 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 4.99.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10407.1.S1_at
|
Corresponding NCBI Gene | 832672 |
Trichome-related Gene from Literature | N/A |