| Detail of EST/Unigene CX528976 |
| Acc. | CX528976 |
| Internal Acc. | s13dNF26A12MJ085_244012 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=2e-95; Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=5e-88; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=1e-76; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=8e-63; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=4e-45; |
| Length | 624 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
| Sequence | TTTCAATCGAACTTGGGATCCGGTCATGTCTCCTTTACTTAAATTTTTGCAGTCGACCGG |
| EST members of Unigene | CX528976 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.45513.1.S1_at
|
| Corresponding NCBI Gene | 814692 |
| Trichome-related Gene from Literature | N/A |