Detail of EST/Unigene CX529111
Acc. CX529111
Internal Acc. s13dNF42A12MJ085_244280
Type Singleton/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Cell division cycle 5-like protein OS=Arabidopsis thaliana E-value=2e-24; Cell division cycle 5-like protein OS=Rattus norvegicus E-value=7e-23; Cell division cycle 5-related protein OS=Nematostella vectensis E-value=7e-23; Cell division cycle 5-like protein OS=Mus musculus E-value=7e-23; Cell division cycle 5-like protein OS=Homo sapiens E-value=7e-23;
Length 156 nt
Species Medicago truncatula
Belonged EST Libraries MT_JAS_ROOR (1 ESTs);
Sequence AAAACACCGAGGATGAAATCCTGAAAGCTGCTGTTATGAAATATGGTAAAAATCAGTGGG
CTCGTATCTCGTCCCTACTTGTTCGCAAATCTGCAAAACAGTGTAAAGCTCGTTGGTATG
AGTGGTTAGATCCTTCCATTAAGAAGACTGAGTGGA
EST members of Unigene CX529111 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family MYB
Transporter Classification Family
Probeset Mtr.6897.1.S1_at
Corresponding NCBI Gene 837506 
Trichome-related Gene from Literature N/A