Detail of EST/Unigene CX529166 |
Acc. | CX529166 |
Internal Acc. | s13dNF42G04MJ024_244390 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 25 OS=Oryza sativa subsp. japonica E-value=5e-74; Putative beta-glucosidase 41 OS=Arabidopsis thaliana E-value=8e-72; Beta-glucosidase 40 OS=Arabidopsis thaliana E-value=6e-57; Beta-glucosidase 34 OS=Oryza sativa subsp. japonica E-value=3e-49; Beta-glucosidase 6 OS=Oryza sativa subsp. japonica E-value=3e-49; |
Length | 584 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
Sequence | TATAGAAGTTACCAACTACATTTCAAGGAAAAACAAGGAGGTAAAATAGGGATAGCACTA |
EST members of Unigene | CX529166 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34957.1.S1_at
|
Corresponding NCBI Gene | 835545 |
Trichome-related Gene from Literature | N/A |